3 Aralık 2015 Perşembe

Cesetlerin Çürümesi İle İlgili Genel Bilgiler

Cesetlerin Çürümesi İle İlgili Genel Bilgiler

-Ceset açık havada bırakılırsa gömülmeye göre daha hızlı çürür. Açık havadaki ceset gömülmüş bir cesede göre 4 kat hızlı çürür.

-Ceset en hızlı 37,5 derecede çürür. 10 dereceye geldiğinde çürüme aşırı yavaşlar . 0 derece ve altında ise tamamen durur.

-Bebeklerin cesedi yetişkinlere göre daha geç çürür. 
-Cesedin bulunduğu ortam nemli , sıcak ve rüzgarsızsa ceset hızlı çürür. Kısacası rüzgar çürümeyi yavaşlatır , nem arttırır. 

-Suyun içinde cesetlerin ağırlık merkezleri baştır. Bu yüzden cesetler suyun içinde kafa aşağı durur. Kaba bir hesapla suda çürüme hızı karada çürüme hızının 2 katıdır. Sudaki cesetlerde çürüme baş ve boyun bölgesinden başlar. 
-Yaz zamanları sudaki ceset ortalama 5-10 günde , kışın ise 2-3 haftayı bulabilir. 
-Bataklıkta ve mineralli sularda çürüme hızı fazladır.

-Suda akıntı varsa çürüme yavaşlar. Denizdense göllerde cesetler daha hızlı çürür. 
-Ceset ne kadar derine gömülürse o kadar yavaş çürür. 
-Şişman cesetler zayıflara göre daha hızlı çürür. 
-Baş bölgesinde kanlı yaralar varsa ceset hızlı çürür. Kalbe bağlı ölümlerde cesedin çürüme hızı fazladır. 
-Vucut ölmeden önce enfeksiyon kaptıysa cesedin çürüme hızı artar. 
-Kıyafetli ve kefenlenmiş cesetler geç çürür.

ilhan



Devamını Oku »

1 Aralık 2015 Salı

DNA Testi Nasil Yapilir ve Adlitip

DNA Testi Nasıl Yapılır ve Adlitıp

Her insanın DNA sı %99.8 aynıdır. Kişiye özgü olan kısım %0.2 lik kısımdır. Bu kısım test için yeterde artar. DNA testi dediğimiz zaman aklımıza ilk gelen babalık testidir.Ayrıca bu test adli tıptada kullanılır. İnsanda 2 çeşit kromozom vardır. Anneden gelen X ve babadan gelen Y kromozomu. Burada Y kromozomundaki DNA lar kullanılır. 

kromozom

Peki Bu DNA'lar nasıl kullanılır ? 

DNA nükleotitlerden oluşan dizilerden oluşmuıştur. Bu nükleotit dizileri bir araya gelerek genleri oluşturur. İnsan DNA sında kişiye özgü tekrarlayan gen bölgeleri vardır. Bu bölgeler belli oranlarda ve sırayla tekrar eder. DNA testinde bu tarz 15 ten fazla gen bölgesine bakılır. DNA örneği alındığı zaman ilk önce izole edilir. Forumda @ThutancamoN açtığı konuda evde DNA görüntülemiştik. Aslında bizde amatör olarak DNA yı izole ettik. DNA yı izole etmek demek üzerindeki proteinlerden arındırmaktır. DNA izole edildikten sonra çoğaltma işlemine geçilir. Bu yöntem ise PCR ( Polimeraz zincir reaksiyonlarıdır.) Bu yöntem ile 1 adet DNA yı bile 1 saat içinde milyarlarca kez kopyalayabilirsiniz. Makineye materyelleri koyar çalıştırır ve bilgisayardan kontrol edersiniz. Sonrasında DNA daha bunu gibi bir dizi işlemden daha geçer.

dna

Şimdi bir örnekle devam edelim. 

15 ten fazla gen bölgesine bakılır demiştik. İnsana ait DNA dizisiyle uğraşmak uğraştıracağı için hayali bir DNA dizisi yazıyorum. 
TTGCAGCTTAGCCCGATTCGATCCCG(A) Bu babanın gen bölgesi olsun. 
TTGCAGCTTAGCCCGATTCGATCCCG(G) Buda çocuğun gen bölgesi olsun. 
Örnekleri karşılaştırdığımızda 1 nükleotit hariç diğerlerinin tamamen aynı olduğunu görürüz. Bu gen dizilerinin aynı olması kişilerin yakın akraba olduklarını gösterir. Baba oğul ilişkisinde birkaç nükleotit hariç dizi tamamen aynıdır. Bu diziler aileye özgüdür. Peki niçin son nükleotitler farklı. Çünkü her DNA kişiye özgüdür. Bu tek bir gen dizisi. Eğer incelenen diğer gen dizileride böyle bir benzerlik taşıyorsa %98 üzeri bir ihtimalle bunlar baba oğuldur. 
Akrabalara bakıldığında ise bu kalıp gen bölgeleri kısmen korunumludur. Baba oğul ilişkisi kadar olmasada benzerler. 
Her ırka ait böyle gen bölgeleri vardır. Nat Geonun yaptığu DNA testindede bu ırka özgü gen bölgelerine bakarlar. 
Bu testin adli tıpta kullanılma mantığıda aynıdır. Bir ceset bulunduğunda kimlik tespiti yapılamıyorsa DNA alırlar. Akrabası olduğu iddaa edilen kişilerden kan ve tükürük örneği alarak bu testi yaparlar. 
Bir programım var. Her türlü canlının DNA ları karşılaştırıp benzerlikleri ve farklılıkları gösteriyor. 

Ek olarak görüntülenen ilk DNA molekülü.

dna molekülü




Devamını Oku »

30 Kasım 2015 Pazartesi

Kendinizi Nasıl Öldürürsünüz? intihar Teknigi!

Kendinizi Nasıl Öldürürsünüz? İntihar Teknigi!


Rahat, acısız ve ızdırapsız bir ölüm için önerilen orjinal metod helyumdur. Eğer sebebini merak ettiyseniz bu intihar rehberi makalesi sizin için.

helyum gazı

İhtiyacınız olacaklar;

1) Bir Helyum Tankı

Helyum, genelde balonları şişirmekte büyük ölçüde kullanılır. Eğer tank 600 balonu yeterince şişirebilecek kadar helyum bulunduruyorsa, daha fazlasına ihtiyacınız olacaktır. 30 dakika için 20 büyük nefes.

2) Uygun Bir Kapak/Tıpa

Bu tankla uygun boyutta olmalıdır. Kapağı açarken dikkatli olun çünkü gaz son derece basınçlıdır. Asla ağzınızı önleyici maske takmadan direkt olarak tankın uç kısmına koymayın. Çünkü bu ciddi bir hasara yol açabilir.

3) Bir Oksijen Maskesi

Bunu tıbbi araç-gereç bulunduran yerlerden temin edebilirsiniz.

Not: Belki maske,gazı havayla karıştırmak üzere düzenlenmiş ve tasarlanmış olabilir. Bu durumda onu modifiye etmeniz gerekecek. Bir koli bandı işinizi görecektir.

4) Dört Ayak Uzunluğunda Kauçuk Bir Boru

Bunu belki maske ile birlikte temin edebilirsiniz. Aksi halde bir nalburdan temin etmeye çalışın. Eğer tankın kapağıyla maske ucunun çağları farklı ise, farklı çapta fakat aynı uzunluktaki bir başka boruyu deneyin. Eğer modifiye etmeniz gerekirse bir koli bandı yardımıyla bunu yapın.

Yapmanız gerekenler:

Eğer içerde bir yerdeyseniz, mümkün olan tüm camları açın. Kapağı tanka yerleştrişin ve şimdide boruyu kapağın ucuna bağlayın. Diğer ucunuda maskenize yerleştirip oturtun. Sızıntı olmadığından emin olmak için gerekli bağlantı denemelerini yapın. Düşmeyeceğiniz bir yere yaslanın veya oturun. Mesela bir kanepe veya yatak olabilir. Yastıklarla destekleyin. Maskenizi yüzünüze yerleştirin. Böylelikle burnunuz ve ağzınız kapanmış olacak. Rahatsız edilmeyeceğiniz bir yerde bulunduğunuzdan emin olun. En azından 30 dakika için. Tankın kapağı açın ve normal olarak nefes alın. Birkaç dakika içinde aniden sesiniz tizleşecek ve daha sonra bilincinizi kaybedeceksiniz. Ayrıca boğulma nedeniyle 15 dakika içinde ölmüş olacaksınız. Ancak sakın unutmayın ki eğer sağ kalmayı başarırsanız, kalıcı beyin hasarlarıyla yaşamaya devam etmek zorunda kalacaksınız.

Sıkça Sorulan Sorular:

1) 600 balon şişirme kapasiteli helyum tankı bulmak veya taşımak zor olmaz mı? / 400 balon şişirme kapasiteli bir tank da işe yarar mı?

400 balon şişirecek kadar helyumla dolu bir tank, 400-800 nefes aralığındadır. Bir balona üflerken kaç kez nefes aldığınızı görmek istemenizde fayda vardır. Bu da, sizin kapasiteniz için daha iyi bir tahmin verecektir. Ayrıca bir dakikada kaç kez nefes aldığınızı bilmeniz gereklidir. Bir kronometre yardımıyla kendinizi ölçün. Tabii ki bu, sizin fiziksel ve duygusal durumunuza bağlıdır.

Mesela üzgün bir haldesiniz. O zaman normalden daha hızlı nefes alırsınız. Rahatlamayı sağlarsanız dakikada 20 nefes aldığınızı varsayalım:

400x1.5= 600 nefes eder.
600/20= 30 dakika eder.

30 dakika boyunca nefessiz kalmak sizi öldürmeye kesinlikle yeterlidir. Ancak problem şu ki; hala bir miktar oksijen almış olacaksınız. Çünkü en iyi maskelerde bile sıkı mühürlenip kapatılmadığından dolayı illaki sızıntı olur.

Pekala o zaman şuna %75 helyum çektiniz diyelim. 

30x75=2.250'den 22 dakika eder.

Ve bu 22 dakika bu işi bitirmenizde oldukça yeterlidir. Yani evet, 400 balon şişirme kapasiteli bir tank da işinizi görecektir. Tabii, iyi mühürlenmiş uygun bir maske temin etmiş olduğunuzdan ve bağlantı denemelerini yaparken fazla helyum kaçırmadığınızdan emin olduğunuz südece. Ama çok küçük bir hata noktası var ve bu yüzden sizd 600 balon şişirme kapasiteli bir tank öneriyoruz. Başarısızlığı ve beyinde oluşacak kalıcı hasarı önlemek için, gazı içinize çekerken asla gazdan kaçmayacağınızdan kesinlikle ve kesinlikle emin olmalısınız.


Devamını Oku »

28 Kasım 2015 Cumartesi

Deep Web'e Nasıl Girilir?

Deep Web'e Nasıl Girilir?


Deepweb'e girmek sandığınız kadar zor deil,fakat girdikten sonraki asamalarda kendimizi gizlememiz gerekiyor.deep web'e girmek için öncelikle tor browser indirin ve kurun.

tor browser

Tor Browser'ı kurduktan sonra gizlenmek için google'den cyberghost vpn indirin ve kurun.karsınıza cıkan ayarlardan istediğiniz ülkenin ip adresine bürünebilirsiniz.



Devamını Oku »

27 Kasım 2015 Cuma

Deep web Nedir?

Deep web Nedir?

Deep web arama motorlarında görünmeyen sitelerin olusumudur.arama motorlarında bize gösterilen sadece %10′luk kısımdır %90’lık kısım Deep web’dir.Türkce karsılıgı “Derin İnternet” anlamına gelmektedir.bu olusuma girmesi oldukca  tehlikelidir.suan internetin 1.seviyesinde yasıyoruz.güvenli seviye dedikleri bu yerde bile yanlıs kullandıgımızda güvenli değildir.


deep web nedir

Sapkın,katil veyahut uyusturucu bagımlısı biri isen zaten her yer tehlikelidir.Bu tehlikenin sebebide sensindir.Deep web internetin 3.seviyesidir.Benim size kullanmanızı önermediğim yer 4.seviyedir.Darknet ve daha alt tabakalarıdır.Bu tabakadaki insanların coğu hackerdir.Kisisel serverleri üzerinden anlık web siteleri acarlar.Basit 1 kac html kodlu siteler üzerinden yayın yaparlar.

Deep web ile aslında istemediğiniz kadar bilgiye ücretsiz erisebilirsiniz.Ne merak ediyorsanız veyahut normal arama motorlarında bulamadıgınız seyleri arayıp bulabilirsiniz.Hemde istemediğiniz kadar bulabilirsiniz.

He ama ne yapmanız gerekmekte ? Sapıkların katillerin ve bu ilanları verenlerin sitesine girmeyin bu kadar basit.Oradan indirdiğiniz bir iceriği sanal bilgisayar üzerinden bir antivirüs ile taratmadan acmayın.

Yani suanki güvenli diye yutturdukları seviyedeki internet saglayıcıları bilgi kütüphanesi ise Deep web bilgi cennetidir.Sadece güvenliğini kendin saglamak zorundasın.

Yani ingilizceniz varsa ve bilincli bir insansanız Deep web size bilgi bakımından kolaylık saglar.Derin internete yani 4.seviye internete bulasmadıgınız sürece 3.derece Deep web’ide temiz bir sekilde kullandınız sürece risk altında değilsinizdir.

Devamını Oku »